Primer pairs used as comparative anchor tags for comparative mapping in conifers

link to the Conifer Comparative Genomics Project (USDA)

last update August 25, 2000



PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene (accession) ((species))

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




4CL

U: CCCCGTCAAATCTGGCTCCT

1127

1400

68

2.5

1600+500

48-56

2

1400

68

2.5


6


(U310404)

L: GGGCGCTTACTCTGCACCAC

genomic clone


(60-68)



52



(60-68)





((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene (accession) ((species))

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




COMT-1

U: AACGCCAGAATTGTGATGAA

453

870

64

3.0

600

60

1.5

1000

61

1

7_1,2

3


(U310301)

L: GGAACTATGCGCCACCATTA

cDNA clone













((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene (accession) ((species))

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PAL

U: TAGCCAAGAAAACCCTGAG

452

452

52TD

2.5

450

48-58

2

452

54

2

2_1,2

6


(U3107102)

L: ACTGATAGCGTCGTAAACCA

genomic clone





56








((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene (accession) ((species))

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




CAD

U: GTCCCCTTACACTTACAATC

156

760

55

2.0

450

52

2

NA




8


(Z371010)

L: ATCCCCACCACTTCAT

cDNA clone













((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




ARA554

U: CAGCAATGACGATGGTTTTA

306

306

52

1.5

MBP



306

52

1.5




(U010554)

L: GGCTGGGGACGAGAAC

cDNA clone


(50-56)


(Multi Banding




(50-56)





((Pinus taeda))






Pattern)









PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




ARA556

U: GAAACCCGGGGCTCTGAACT

455

455

56

1.5

NA



455

56

1.5




(U010556)

L: CCGCAGCGAGGAAAACAA

cDNA clone


(56-64)


(No Amplification)




(56-64)





((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




CHS

U: ACTCCCCCTAATGCGGTTGA

370

370

64

2.0




370

64

2.0

2_3



(X60754)

L: CTTGGCTGCGGCTTCTTTC

genomic clone


(54-64)






(54-64)





((Pinus sylvestris))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




STS

U: CTGTAGGAATGGGCGTTGAT

776

NA






NA






( X60753)

L: GATTGCTCCGTCGCTGTT

cDNA clone













((Pinus sylvestris))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




ICL

U: GGGGTAACACTGGCAATGTT

678

1600

56

2.0

NA



1600

56

2.0

5_1,2



(U310807)

L: GCACAGTACCCGCACCAA

cDNA clone


(54-60)






(54-60)





((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PCHILDE

U: CTGGGCCACTTTCTTCTATC

1047

1000+1020

60

1.5




1047

60

1.5

unlinked



(X66727)

L: CAAGCCCTCTCAGGTCAC

genomic clone













((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




NIR

U: AAAGCAAGAGCCCTGAAAAT

303

303

56

2.0

NA



303

56

2

7_3



(X7410410)

L: CCTGATGGCTCCAAAGTG

cDNA clone


(54-60)






(50-60)





((Pinus sylvestris))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




SODchl

U: TCCGTTTGACAGGATTGACT

284

1050

60

2.0

1000

54

2

1050

60

2.0

5_1,2 ; 10_3



( X585710)

L: CCCCAGGTCATCCTCTAACT

cDNA clone


(50-62)






(50-62)





((Pinus sylvestris))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




SODcyt

U: TGGGTCTTCTTAAGGCTGTT

383

700

48

2.5

1000

48-54

2.5

NA






( X58578)

L: GCCAAGATCATCAGGATCAG

cDNA clone


(48-50)











((Pinus sylvestris))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




GS

U: AAGTTGGGCTGCACGT

600

1300

58

1.5

NA



1300

58

1.5

2_1,2



unpublished

L: TTGGAAGCTGGCCTGC

cDNA clone


52-60






52-60





((Pinus sylvestris))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




GLP

U: GGGAGGCCATGTCTGAAT

2010

2010

52

2.0




2010

52

2.0

7_1,2



(AF0310201)

L: GGGTGAATATGGGGAGGTA

cDNA clone


(48-56)






(48-56)





((Pinus caribaea))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




lp2 SAM

U: GATTTGCCGTGCTGTTTGCT

631

1400

58

1.5




1400

58

1.5




synthase

L: TCGTGCTGAGTGGAGATGAGAA

cDNA clone


(58-66)






(58-66)





((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




lp3-1 ABA/ripening inducible protein

U: GGAGGAGAAACAGCACCAC

716

MBP

48-58

2.5




716

62

2




(U52865)

L: CGGAAATCACACGAAAAGAA

cDNA clone













((Pinus taeda)) PtIFG28810















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




lp4 stellacyanin

U: ACATACACCAGTGGCAACGA

5810

1000

52

2.0




NA






((Pinus taeda))

L: GACGGACATGAACCCAATG

cDNA clone


(50-52)











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




lp5 glycin rich protein

U: CCGGACTTCTGTTTGCTT

773

MBP

63

2.0




smear






(AF013805)

L: ATGGCCACACAATACACTGT

cDNA clone













((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




lp6 chitinase homolog

U: TTTCGCTTCCCTTCATTTTC

787

MBP

56

2.0




NA






(U313010)

L: TTCCACATTCGGCATCTG

cDNA clone













((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




lp8 Ca Binding protein

U: TGATTTCGGAGGCGGAGAT

461

461

64

1.5

MBP



461

64

1.5




(AF013802)

L: GCGCTGAGAGCTGAGGTAGG

cDNA clone


(50-64)






(50-64)





((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




ptxmyb413 (myb I)

U: TCACCCCAGGAAGAACAAT

2610

660

56

1.0

MBP



540

56

1.5




(unpublished)

L: AATGAGGTTGTTGGTGGC

genomic clone


(51-56)






(48-58)





((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




ptxmyb126 (mybII)

U: AGTGGGATTGAAGAAGGGT

500

450

52

2.0

280

50

1.5

450

52

1.5




(unpublished)

L: CCAACGCAATCTACAACT

genomic clone


(51-54)






(51-54)





((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




Peroxydase (compression

U: CCGATGCTGCTCTTCTAAC

475

500

52

2.0

MBP






8_3



wood responsive)

L: AGCGAATTTGGAGGATGA

cDNA













(AF028073)















((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




Ferritine ((compression

U: ATGGAGCTGACTTTGTCTTT

4510

800

57

2.5

550

48

3




2_1,2 ; 5_3



wood responsive)

L: GAGGGCTAATTGAGAAACAG

cDNA




1000









(AF028072)















((Pinus taeda))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




Myrcene Synthase

U: GGCTTGGGAGGCTTATTTTG

cDNA

NA



300

50-52

2







(U871008)

L: GGGCATCTTCTTCGGTTGA

335













((Abies grandis))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




Pinene synthase

U: CCTCCCTCATTGCCTTTCC

cDNA

800+600

60

2.0

MBP






8_3

24


(U8710010)

L: AACCCGATTCTTTCCACCAT

327













((Abies grandis))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




Limonene synthase

U: GGCTCTCCTTTCTATCGTAT

cDNA

350

52-57

2.0

MBP









(AF0061103)

L: CCACCACCATTATCATCA

1105













((Abies grandis))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




SAM lp2 drought inducible

U: CCGACAGCAAGGTAGCAT

cDNA

380

56-54

2.0

350+500

60

2





20


(U38186)

L: GGGGCAGGTTCCATTCT

380













((Pinus banksiana))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda


primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RbcS Ribulose Biphosphate Carboxylase Small Subunit

U: ACC CCA AGT TTG AGA CTC TG

331

450

56-58

2

450

56-58

2







(X13408)

L: GGC TTG TGG ACG ATG AAG

cDNA


58



58








((Pinus thunbergiana))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from conifer genes available in GenBank (a)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene (accession) ((species))

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




Pepc : Phosphoenolpyruvate carboxylase

U: GCT GCC TTC CGC ACA GAT GAA A

1150











23


(X7100100)

L: CCT ACC AGC ATC CTT TCC AGA A

cDNA

1800

48

3

1800

48

3







((Picea abies))















PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (b)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PtIFG11017

U: ATATCCGTCGCCTGGTTAAG

320

NA



500

58

2





14



L: GATTCTCAAAGCAGCCCAAG

cDNA













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (b)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PtIFG1584 deoxychalcone synthase/NADPH reductase

U: CGAAGCAAAGGATGTCACG


340

(54-56)

1.5

350

56-58

2




4_3




L: TGTTGAGGTGGGGATTGG

cDNA


54



56








PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (b)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PtIFG1750

U: TGTTTACGTTCTTGACGCGG

300

340

54

2.0

NA








11


L: TAGCAAGCACTCTGACTGTGG

cDNA













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (b)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PtIFG1165

U: CTGAGGGGATGTGCATGAC

250

360

(62-60)

2.0

MBP








6


L: AAACCAGCAGCCACATGAG

cDNA


60











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (b)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PtIFG7310

U: TACAAAGGCTCGGGTATTGG

350

350

(56-58)

2.0

400

(48-58)

2




5_3

6

6


L: GTCATGCCTAACAAGCCCTG

cDNA


58



56








PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (b)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PtIFG107 Beta chain chloroplast ATP synthase

U: GCAGGACCTTCTGGACAATC

450

420

(60-51)

1.5

MBP








1


L: AGGTGGAGAAAGCCAAGCTC

cDNA


60











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (b)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PtIFG22100 light harvesting complex chlorophyll a/b binding

U: AGCTTGCAGCATCAACCG

650

820

(61-641)

2

300

50

2






10


L: GAACCAAACAGCTTCAGGACC

cDNA


62











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (b)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PtIFG11056

U: GAAGCTAGCGAAGGCTTTGG

410

350

(51-52)

01/05/2000

350+450

48-58

01/05/2000





6

10


L: GGGTGTGACCATATAACACCG

cDNA


51











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (b)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PtIFG1576

U: TGGTATGTGGAGGGAAGGC

480

380

(61-60)

1.5

MBP








1


L: TACAGCGTTTGCTCCTCCTG

cDNA


60











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (b)

Pinus pinaster


Picea abies


Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PtIFG464 plasma membrane intrinsic protein

U: TGTCACTGCCCAGAGCTATTC

450

600

(60-55)

1.5

650

50

3








L: ATCACAGCCGCTCCAAAAC

cDNA


58


1300






2


2

PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (b)

Pinus pinaster


Picea abies


Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PtIFG624

U: CACAATTGCCAGATGGGTC

620

1000

(61-57)

1.5

1000

48-58

2





10

10

protein kinase

L: CCTCTCTAGCAACGATCCG

cDNA


60



52








PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




606, entE gene

U: TCA TGA GGG GAG AAA GTT GG

360










6_3

6

6


L: GGG CAG TCA CTT GAA CTT CG

cDNA










PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




1643, ABI1 gene product

U: AAT GGA GGA TGC CGT TAC AG

4100










10_3


10

(H751101)

L: AAC CAC TCT CGA ATC CCC AC

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




1764

U: TGA TCG GTG TTC AGG CAA G











6_3


6

(H75123)

L: TGTCTCACCCTCCTCCAAAG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




2274

U: TGA TCA GAG AGC TGG TGC AG

400










4_3


4

(H75066)

L: AGA TGA GCA TCA GGT CAG CC












PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




2358

U:GTT AAC CCT CGA GGA GAC ATG

330










6_3


6


L: GCT TCC ACA GTC CAC AAT CTG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




84210

U: cgcgcggGTTGAAAGCGACTCCAAAGG











4_3


4

(AA7310505)

L: GAGGCATTTATGAGGGAACG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




8436

U: cgcgcggGACAAGGATCCAACTCTCAGC











7_3


7

(AA7310508)

L: TGAACTTGTCGGTGCTTAGG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




8580

U: TGGAAACCGTCTACAGTCGC


200

48

3







10_3


10


L: ACTGGATTCCGGAGGATCAC

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




8656

U: CACCAAGTACACCACAACACC

200










unlinked


unlinked

(AA7310632)

L: ATTTGTGGCTGCGGAAAG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




8702, Thioredoxin

U: AGT CGC ACT TGC TCC AGT TC

2100










6_3


6

(AA7310652)

L: GTT GCA GAA AAG GGT GGC

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus

Picea

Pinus

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

pinaster

abies

taeda

87710

U: TCAAGTCAGTTGCTTGAACATC











5_3


5

(AA7310708)

L: ccggccgggAGGATTCGCGGTGAAAGG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




88108, plasma membrane intrinsic protein WD40-repeat type I

U: ATG GGG GTG CAG CAT AAA C

330










4_3


4


(AA73107106)

L: GGG ATG GCA ACA ACA AAA AG

cDNA










PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




81007, cationic peroxidase

U: TGG GTG AGA CTT ACG AAC AGG

300










8_3


8

(AA73107107)

L: TCC TCA ACA GGC AGA CCT TC

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




810310, ribosomal protein 40S S16

U: AAC CAC GAG CTT GGC ATG

300










2_3


2

(AA7310822)

L: ACG TGG ACG AGC AGT CAA AG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




81072, protein 2 major intrinsic plasma membrane

U: GCC TCC ATT CGA CTC ACT TG

310










6_3


6

(AA7310836)

L: TTG GTC CCC TTG TTG GAG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




10036, ribosomal protein L37

U: GTC ATC CGA TAC AAC CTC AAT C

250










7_3


7

(AA7310871)

L: CAG GAC GAA TGA GAT ACC TGC

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




10044, ribosomal protein 40S S27

U: CAT CGC ATC AGT CAT ACT CAC C

280










6_3


6

(AA7310876)

L: CGC GGC CCA ACT GGA GGA AAA GCA CGA C

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




100102, nonspecific lipid transfer protein

U: AGCTAAAGTTGGCTGGCATC

270










5_3


5

(AA73101007)

L: GCCGGGTCACTGACCTTAACGTCCC

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




10136, ribosomal protein S11

U: CCGATTTGAAACACACATCC

260










3_3


3

(AA73101040)

L: GCCGGCCGGGCCCTTGTCCAAGACTGTAAG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




10151, Cucumber basic protein, a blue copper protein electron

U: GCAGAATCTCAGCAGCAATG

2100










7_3


7


(AA73101054)

L: TAGTGAGCCCTGGAGCGTAC

cDNA










PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




464, plasma membrane intrinsic protein

U: TGT CAC TGC CCA GAG CTA TTC

450













(H75150)

L: ATC ACA GCC GCT CCA AAA C

cDNA










2_3


2

PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




8103, non specific lipid transfer protein

U: GGA CTG AAG GGA TCT AGC TGG

450










5_3


5

(H75118)

L: CAG CCC AAA TTC CAT CGT C

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




1623, Gry-rbp

U: TTT CTC AGG TGG GAG AGG TG

350










2_3


2

(H751010)

L: TCG CAT CCA TGT GCG TAG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




2781

U: GAT GAT GCC CTG AAG AGC C

450










8_3


8


L: ATG GAA CCA AAG GAG ATG CC

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




48, aquaporin

U : GAC ATT TGG ACT CTT CCT GGC

270











2

2

(H75016)

L : AAC ATG AGA ATC ACG GGC AC

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




7310

U : TAC AAA GGC TCG GGT ATT GG

350











6

6

(H75167)

L : GTC ATG CCT AAC AAG CCC TG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




8732

U : gccATGCACAGGATGAACCCTTC












8

8

(AA7310680)

L : ggcccggcggccggTGAAGTTCTGAGTTTGGCGG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus taeda ESTs (c)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




10076, Phosphoglucomutase

U : CTC TAT TGC AAA AAT GTG CCA C

250











11

11

(AA73108107)

L : AGAATTTACTGGCCGCTCG

cDNA











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AN01A05

U: TCG TCT CGC ATG GCA CTC TG

cDNA

200

50-58

2

MBP









Cytosolic ascorbate peroxidase

L: GCA GCC TGA TCG CAA TGT CA

131













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AN01B07

U: TGT GAA AAG GAA GCG GTG AA

cDNA

250

50-58

2

250+450+800

48-56

2







Chloroplastic carbonic anhydrase

L: GGA AGA GTG ATG GCA AGC AA

237


50



50








PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AN01B11

U: AGC CAA TGC ACC AAG AAG

cDNA

250+300

54-58

2

MBP









Metallothionein-like protein

L: CCG CCT CAG AGG TTA CAT AG

223













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AN01C010

U: CGC CCT CTT CTA TTA CTG CT

cDNA

160

56-58

2

180

56-58

2







Photosystem I

L: CAC CGC TGC TCT CCT C

161


56



58








PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AN01D01

U: CCC CGC TAC TGC TAT CTT CT

cDNA

155

48

2

155

48-58

2







2-cys peroxyredoxin

L: TGC CAA TCG TGT GCT GA

155













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AN01D04

U: TGC ACA CGG CTC TCT GAA CC

cDNA

160

56-58

2

160

54-58

2







Alpha-tubulin

L: CGT GCC CAA GGA TGT CAA TG

161


56



56








PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AN01D07

U: CTG GAA CGG GCA AGA CAG C

cDNA

155+300

48-58

2

155+300

48-52

2







NeIF-4l7

L: GAT GGT AAT CGG GGC GAA AA

2106


50



50








PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AN01E04

U: TGA TGT TAT TGA GGG GTT GA

cDNA

1000

48-52

2

250+750

48-54

2







Glycin decarboxylase (H subunit)

L: TCG GTT AGT TTT GTG TTG GT

252


52



52





7_3

7


PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AS01A03

U: CCC ATC TCA CAC ATA ACA AA

cDNA

200

48-56

2

MBP









DAG protein

L: TCA CTT CCG ACG ACC TT

200













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AS01A06

U: GCT GGT CAG GCG GGA TTC

cDNA

NA



NA









Polyubiquitin

L: AAC CCC TTG CCG ATT CCA AT

1101













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AS01C03

U: GGC CTC TCC ACC CGC ATT CT

cDNA

220

54-58

1.5

220

54-58

1.5







Chloroplast ATP synthase gamma subunit

L: GAC GCC CGT TCA CCA CAG C

222


54



54






8


PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AS01C04

U: GTA ACC GGG AGC GTA TTC A

cDNA

NA



300+800

48

2.5







Cytochrome c reductase hinge protein subunit

L: GCC CAG TTT CAT CTT GTT CA

155













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)


110


AS01C10

U: GGC CCC CAT CCT AAA ATG AA

cDNA

1000

48-58

2

1000

54

2







Beta carotene hydroxylase

L: GAA GGG CCT CCA AAA GCA CT

21010


54











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AS01C07

U: ACG CAG AGT AGA AAC CAA CA

cDNA

250+300+35

54-58

1.5

300

48-56

2







Heat shock protein

L: TCC CAG ACA AGA CAA ACA AT

183


54



54





10_3



PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AS01D10

U: CCT CTG CTC GCA CCT TGG TC

cDNA

250

64

2

MBP









Thiasole biosynthetic enzyme

L: GTA GCG CCG GGT CAT CTC C

250













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AS01E07

U: AAG GGG CAG GGT GGA AT

cDNA

350+400

54-58

2

350+400

58

2







V-ATPase subunit G

L: CCT CTG TGC CCG ATA AGA AG

147


58











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AS01F10

U: CAG GAA AGG GTA AAG ATG G

cDNA

150

48-56

2

400+1000

48-50

1.5







Cellulose synthase

L: TGT AGG TGT AGT GGC AGG TA

1110


56



48








PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AS01F03

U: GAG AAC CGA ACA GCA GGA AT

cDNA

180

56-58

2

150

50-56

2




4_3

4



L: GCA TGA ACT CAG GGG ACC

176


56



50








PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AS01G01

U: GAG AAT TGG GTG TGT TGT TA

cDNA

300+350

48-58

2

450+500

48

3




1_3



Eukaryotic initiation factor

L: TCG CAG TTG TGT GAA GAT

286


48











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




AS01G08

U: CGA CCG TAT GCC TTA TCT TT

cDNA

200

48-58

2

NA









(S)-N-methylcoclaurine 3'-hydroxylase

L: ATC CCT CAA TCT CAC AAT CA

110













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01B03

U: TGC CTC CCA CAC ATC CAA TC

cDNA

300

48-58

2

MBP









14-3-3 protein

L: TCC CCA TCT TCC ACC TTC GT

277













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01B010

U: CAG CCA CAT CGA CGA CTC AT

cDNA

MBP



MBP









Cobalamine-independent methionine synthase

L: CGA GGT CAT TCC CGC TCT AA

262













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01C01

U: TGT CGC TTA TGG TGC TGC TG

cDNA

NA



MBP









Heat shock protein hsp70

L: CTT GGC TCT TTC CCC CTT CA

247













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01D02

U: GCT GCT TGG ACC GAC GCT AT

cDNA

250

48-56

2

250

48

2







Subtilisin-like protein

L: CGT TTC CCC GTT GCT TCA TC

235


48











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01D11

U: GAA TAC CCC GGT GGC TCA T

cDNA

220

58

2

MBP









Chitinase

L: AGC ACA AAC CCC AAG CAG TT

2010













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01E02

U: GGA AAG CGT GTG GCA GAA AC

cDNA

MBP



MBP









Thymidine diphospho-glucose 4-6-dehydratase

L: CCC CCT TCC AAA AGT CCT GA

254













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01E03

U: CGC TGC TTC TGG TTC TGC TT

cDNA

MBP

54-58

2

MBP



MBP






Plasma membrane ATPase

L: ATC GTC GCT GTC GTC CGT AT

140













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01F06

U: CTT TAG GGA CTT CGC AAC TG

cDNA

250

52-58

2.5

400

48-52

2.5





1


Cationic peroxidase

L: TGA GAG CGC ATT AGA TTT CA

241


52



52








PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01F10

U: CGC AGC CCA GCA GTT CTT A

cDNA

220

54-58

2

220

54

3







Peroxidase basic isozyme

L: GGC AGC CCT CTT CAC TTC TG

184


54











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01G01

U: GGT GGT TGG AGC GAA CAT CT

cDNA

250

56-58

2

200

52

2







Tonoplast intrinsic protein gamma

L: CAG GGA GCG GGG TGT G

200













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01G02

U: AAG ACC GCG GAC CAT CAA G

cDNA

200

48-54

2

160

48-58

1.5







2-oxogulutarate 3-dioxygenase

L: GCC TTC CGC CTC CTT TAC AA

126






40 cycles







PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01G04

U: GCG TCG CCG GTA TCA AAA TC

cDNA

210

54-58

2

210

48-52

1.5





11


Casein kinase II alpha subunit

L: CAC CCC ATT GCA CTG TGA GC

175


56



52








PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RN01G08

U: AAA TGC CCA AGT CAA CA

cDNA

430

54-58

2

MBP









Chilling tolerance related protein

L: GTA ATA AAG ATG CCC AAC AA

1310













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RS01A11

U: TGC GAT GCC ATG CTT GTT GT

cDNA

MBP



MBP









Annexin

L: GGT GCC CGG TAT TCC TTG CT

147













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RS01B10

U: GGG GCT TTT CTA TTC TTT GC

cDNA

300

52-58

2

MBP









Nodulin-like protein

L: AGG CCC TAA ACA GTC ACC A

2104













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RS01C11

U: GCC ATC AAG AAA AAT AAA AC

cDNA

NA



MBP









Geranylgeranyl pyrophosphate synthase

L: CCA ACC TAC CAA ACC AA

225













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus

Picea

Pinus

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

pinaster

abies

taeda

RS01D10

U: AAA AGC CCG TAA GTC TGT GA

cDNA

200+300+700

54

3

200+220

50-56

2





10


Transcription factor

L: TCC CTC CAA AAC CTC CTC

150

1200




50








PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




RS01D05

U: ACG GGC CGA GGA ACT GGA CC

cDNA

210

52-58

1.5

210+1000+1200

58

2-2.5




7_3



MYB-related protein

L: GCA GGG CTC GGG CAA TCG TT

1101


52











PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PA10

U: GCA GCG TTC GTC TTC ATA AT

cDNA

340

48

2







6_3




L: GCG GTC ACA TGG AAA AAC T

328













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PA12

U: ATT AGC AGG GCA TCT GTC TG

cDNA

400

52

2







8_3




L: CAC GCC TCT CAT TTT CAT C

3103













PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Pinus pinaster ESTs (d)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PA22b

U: CTG GGA TGA GAT TGA AGA

cDNA

250

48




2-2.5




10_3




L: GTG ACT TGG ACG AAA ATA AT

256













PRIMERS

Amplification conditions

Linkage groupg

Picea abies/Pinus pinaster consensus primer pairs (e)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PPA1: (AS01E07/PASE1367)

U: AAG GGG CAG GGT GGA AT

400

MBP



MBP










L: AAGGATACCAATTTTGCCCTA AA














PRIMERS

Amplification conditions

Linkage groupg

Picea abies/Pinus pinaster consensus primer pairs (e)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus

Picea

Pinus

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

pinaster

abies

taeda

PPA2: alpha tubulin (AN01D04/PAXYM85)

U: CAG AAA ACT CGC CCT CTT

200

350

48-50

2

350+400

48

3





8



L: AAA TAC ATG GCC TGT TGT CTT



48











PRIMERS

Amplification conditions

Linkage groupg

Picea abies/Pinus pinaster consensus primer pairs (e)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PPA3: cab 1 (AS01H07/PASE11210)

U: AGT ACC TCG GCC CHT TCT C

300

MBP



MBP










L: GCC CAG ATG GCG ARD ATG














PRIMERS

Amplification conditions

Linkage groupg

Picea abies/Pinus pinaster consensus primer pairs (e)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PPA4: extensin (RS01D03/PAXY3210)

U: ACA AGC CAC CAG TAC CAG TCA

300

MBP



MBP










L: AGG TGG TTT GGG CTT AGG RAT














PRIMERS

Amplification conditions

Linkage groupg

Picea abies/Pinus pinaster consensus primer pairs (e)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PPA5: ribosomal protein L37 (RS01G03/PAXY330)

U: GGT AAG GGA ACG GGA AGT

400

NA



MBP










L: TGA ATT AAT TTG TCA TCCGATAC














PRIMERS

Amplification conditions

Linkage groupg

Picea abies/Pinus pinaster consensus primer pairs (e)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PPA6: lp3 (AS01H03/PASE150)

U: GCC CCC GGA GCC TTT G


350

48-50

2

MBP










L: TCC TTT TAA ATC TTG GGCCTG TG














PRIMERS

Amplification conditions

Linkage groupg

Picea abies/Pinus pinaster consensus primer pairs (e)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PPA7: (RS01G05/PASE126)

U: AAA GCG TTT CTG GAA CRK KTTA

350

400

48-58

2

400+700

50-58

2.5




1_3




L: GTT TTG GTC AAG GCA ATC C



50

1µM primers


50








PRIMERS

Amplification conditions

Linkage groupg

Picea abies/Pinus pinaster consensus primer pairs (e)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PPA8: (AS01H04/PASE10) ribulose bisphosphate carboxylase small subunit

U: TAG CTG CTC CCC TCA AGA CC

380

350+400

54

2

400

54

1.5








L: GGC ACC CAC TTG TTC CTC A











10_3



PRIMERS

Amplification conditions

Linkage groupg

Picea abies/Pinus pinaster consensus primer pairs (e)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PPA10: Ubiquitin (AS01A06/PAXY2110)

U: TGG CAT GCA GAT TTT YGT YAA

210

300+500

48-52

2

300+500

48-58

2








L: GATCGTCTT TCCAGTGAG GBTYTT



50

1µM primers


50

1µM primers







PRIMERS

Amplification conditions

Linkage groupg

primer pairs designed from Picea abies ESTs (f)

Pinus pinaster

Picea abies

Pinus sylvestris

Pinus pinaster

Picea abies

Pinus taeda

Gene

primer sequences (5'->3')

Expected length

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)

Observed length

T° (range)

MgCl2 (mM)




PAXY13 Aquaporin

U: CCAGAAGCCCTACTATGACA












2



L: CCGCTCCAAAACTCCTT



























































(a) most of them published in Plomion et al. (110109) Mol Breed 5: 21-31















(b) communicated by D Neale and Garth Brown















(c) PCR conditions described by Harry et al. (110108) in Theor Appl Genet 107: 327-336

(d),(e) and (f) other primer pairs designed at INRA Pierroton





(g) Linkage group_Map